Top Resources Top Resources
Web Results
  • 1.
    Sequence - Wikipedia, the free encyclopedia
  • ... uses, see Sequence (disambiguation). In mathematics, a sequence is an ... For example, (C, R, Y) is a sequence of letters that differs from (Y, C, R), as ...
  • http://en.wikipedia.org/wiki/Sequence
Questions/Answers
sequence ?
Find the general term of the sequence, starting with k=1. 1/2 , -3/4 , 7/8, -15/16, ...... show your work please Thanks in advance!
I am assuming that this sequence is: 1) 1/2 2) -3/4 3) 7/8 4) -15/16 I will call the term #k a(k). (I have to call it something with a k. :) ) where the 1), 2), 3), and 4) are the values of k. I don't see any confusion here at all. Since the signs are sequentially minus, plus, minus, plus...we need the term (-1)^(k-1). Since(-1)^0 = 1, this causes no problem with the first number. The denominator is 2^k, and the numerator being one less than the denominator is [(2^k) - 1]. Combining these we get ...........[(-1)^(k-1)] * [(2^k) - 1] a(k) =.---------------------------- ------ .........................(2^k) Since Yahoo Answers will not accept more than two blank spaces, I had to use periods to make the fraction come out right. .
How to translate andtranscribe a genetic sequence?
I need to translate and transcribe a genetic sequence. I have found calculators and translations/transcriptions of other sequences but can't seem to find any instruction on how it's done. The sequence is: CCGTAATACGCTTTCGCCATGCCTTGCACT GGCCCTTA I should warn you, I am a Journalism major and I'm horrible at biology, so if you know the answer and can help me please keep in mind that I'm kind of an idiot when it comes to this stuff and explain it as simply as possible. Thank you!
Well, a genetic sequence is DNA, and DNA has two strands, which are complementary. There is a forwards and backwards way to read any strand. So what you're given here is incomplete, and you will have to make some assumptions. Let's start out assuming you are being given the strand that is literally the template for the transcription enzyme, written forwards (5' end at left, 3' end at right). Transcription is when an RNA polymerase enzyme makes a new strand of RNA (messenger RNA), using the DNA as a template. So the new RNA has a sequence complementary to the DNA, and its "beginning" (5' end) is complementary to the "end" (3') of the DNA. Also, RNA has U instead of T. C and G are complementary A and U(or T) are complementary. 5' CCGTAATACGCTTTCGCCATGCCTTGCACT GGCCCTTA 3' (DNA) 3' GGCAUUAUGCGAAAGCGGUACGGAACGUGA CCGGGAAU 5' (RNA) You might want to double check my transcription, I did it quickly and could have gotten some letters wrong. I don't think I did. A 5' end is the "beginning" of the RNA sequence, because the ribosome translates RNA into a polypeptide (protein) sequence going in the 5' to 3' direction. So you flip it around for translation. 5' UAAGGGCCAGUGCAAGGCAUGGCGAAAGCG UAUUACGG 3' For assignments like this you are usually supposed to find the reading frame by finding the first AUG. A ribosome will begin polymerizing amino acids into a protein when it finds an AUG, and every subsequent triplet of letters is translated into an amino acid. You look up the triplets (codons) on a table of genetic code, and get the amino acid sequence (polypeptide; protein). When you come to a stop codon, that's the end of the translation. The first AUG in this sequence is pretty far in... 5' UAAGGGCCAGUGCAAGGC AUG GCG AAA GCG UAU UAC GG 3' and there's no stop after it. Also the sequence begins with a stop codon... This makes me think that the author of your assignment has written the DNA sequence 3' to 5' to, uh, simplify things, haha. If that were the case you'd get RNA 5' GGCAUUAUGCGAAAGCGGUACGGAACGUGA CCGGGAAU 3' and you could translate it starting with that handy dandy AUG that is only seven nucleotides in. AUG CGA AAG CGG UAC GGA ACG UGA CCG GGA AU Met Arg Lys Arg Tyr Gly Thr Stop That is the answer I think I would put. It sort of makes sense, because the new RNA is actually put together starting at its 5' end, so polymerization would begin using the 3' end of the DNA template strand... so it'd make sense to write the DNA with 3' end at left. Look for clues about how the original sequence is oriented. Sometimes, DNA gene sequences are written as the "sense" strand -- which is exactly the same sequence as the RNA, only with T instead of U. If that were the case here, though, there would seem to be little point in asking you to transcribe it.
What is the difference betweena sequence and a series?
Sometimes I treat sequences like series and then use a corresponding test on them. However, I'll get the answer wrong, becaue I treated it like a series instead of a sequence.
A sequence is an ordered set of "things". {a,b,c,d,e,f,g,...} A series is a summation over a sequence. Sum({a,b,c,d,e,f,g,...}) = a + b + c + d + e + f + g + ...
Submit your question
knowledge base
* Indicates a required fieldAdd your knowledge or ask a question:
  • Display Name:(letters/numbers, no special characters)
  • Your knowledge or question:*
    (min: 100 characters, max: 2,000 characters)
  • Character count: 0
Privacy Policy | About ToseekA.com | Contact Us | Popular Searches
© 2009 ToseekA.com
Portions of this page powered by: yahoo!